Sanger Sequencing


The TCGA performs Sanger sequencing on PCR products, plasmids, single stranded DNA, double stranded DNA, cosmids, BAC DNA and bacterial genomic DNA using an Applied Biosystems 3500XL Genetic Analyser.

Sanger sequencing remains an informative, quick and cost effective tool for use in life science research. It can be performed with user-supplied primers or any of the TCGA’s standard sequencing primers. Templates for sequencing can be supplied in individual tubes or 96 well plates.

Template/primer concentration guide

Template Template concentration Minimum volume required Primer concentration (3 µl per reaction)
Plasmids 150-500ng/µl 5 µl 3.2 pmol/µl
PCR products:
           100-200 bp 1-3 ng/µl 5 µl 3.2 pmol/µl
           200-500 bp 3-10 ng/µl 5 µl 3.2 pmol/µl
           500-1000 bp 5-20 ng/µl 5 µl 3.2 pmol/µl
           1000-2000 bp 10-40 ng/µl 5 µl 3.2 pmol/µl
           >2000 bp 20-50 ng/µl 5 µl 3.2 pmol/µl
Single stranded DNA 25-50 ng/µl 5 µl 3.2 pmol/µl
Cosmid, BAC DNA 0.5-1.0 µg/µl 5 µl 3.2 pmol/µl
Bacterial genomic DNA 2-3 µg/ul 5 µl 3.2 pmol/µl

Lower template concentrations may be analysed, please discuss with the TCGA.

PCR products should be purified to remove unincorporated dNTPs and primers; we recommend Illustra ExoProStar™ 1-step (Fisher Scientific catalogue number #12124082) or ExoSAP-IT™ PCR Product Cleanup (Thermo Fisher #78250.40.UL).

DNA Sequencing Request Form

Standard Sequencing Primers

The following standard sequencing primers are available through the TCGA:

Name Sequence (5` to 3`) Length
M13 rev (-29) CAGGAAACAGCTATGACC 18bp
M13 rev (-49) GAGCGGATAACAATTTCACACAGG 24bp
M13 uni (-21) TGTAAAACGACGGCCAGT 18bp
SP6 CATTTAGGTGACACTATAG 19bp
T3 AATTAACCCTCACTAAAGGG 20bp
T7 TAATACGACTCACTATAGGG 20bp
T7 term CTAGTTATTGCTCAGCGGT 19bp
pCR 3.1 (BGHrev.) TAGAAGGCACAGTCGAGG 18bp
pGex for ATAGCATGGCCTTTGCAGG 19bp
pGex rev GAGCTGCATGTGTCAGAGG 19bp
CMV-for CGCAAATGGGCGGTAGGCCTG 21bp
CMV-rev CCTCCACCCCATAATATTATAGAAGGACAC 30bp
U19 GGTTTTCCCAGTCACGACG 19bp

Please contact us with any questions or requests.